SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00002600_2.0
Identity
PromoterSelenoprotein P (SelP)
SpeciesTaeniopygia guttata (Zebra Finch)
Promoter IDSPR00002600
Promoter release2.0
External IDNone
Transcript SPT00002535_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

ToolboxForward   Reverse    
Sequence
>SPR00002600_2.0 # Promoter # Selenoprotein P (SelP) # Zebra Finch (Taeniopygia guttata) Full length # Reverse
AGGTGGCCAGGGCCAGCACCAACAGCCCCATCCTGGACCCTGGCCCTGGCAAGGGGACAT
GGGGTGTTACTCTCCTCCCAGATCCACTGCAACCCCAAAACACTTCCCTGCAGCCTGCTC
CAGGGCAGACAAGGGTGTGGGCAGTATTGGCCTGATCCTGGCATTGGGGGCCAGGACCCC
CATCCCGGGGGGCAAGGAAATGGGTACGAGGTGGGGAACTGGGCTCCTTGCTGCTGTCTT
TTGTGGGCACCCACTGCTACAGCATCCTGTTCTCCCCTGGCAGTGAAGACCCACTCCATA
TCTCAAGAGAAGAAGGTACTCCTCTGCCATGGGCCTTCTCCATTTCTTTGATCCCACAAA
ACAAACCCAGCCCCAGAGAGAGGTCTGACTTTGCCCCAGAAGGGAGCAGGGATACAGCCC
TCATCATCTCAGCTGCCAGTGAGCAGTCACTGGGACAGAGATGGTTTCACCTTCAGGTCA
CCTTGAGAATCCTTGATGCCCCACGAAGAGCTTTGGGACTACACAAAGCTTTTAAAACCC
TTGAGTCTCCCAAAATTTGCCTGAAGCCCTGTCCTCCAACAGCTCTCTAACTCTGCCCAT
CCCAGGATATTGCCCATCCCTCTAATACCCAGCACACTCAATGGGCAAGAGGGAGGATAC
GGGTCTGGAGGGAATGGTCTGGGGAGGGAGCAGGGAGATGCAGGATCTGGACAGGGTGGA
TGTCCCCCCACTCCCCAGCCCTCTCCCCGCGAGAACAAGCCCTCGATACCGCACTTCTCC
TCGCTGCCGTCCTCCTTCGCTCCGGGCCCCAGCAGTTTTCAGCAACTTCCAGCTGGCCCT
GGTCCCCCTTTTATCTCCTGACCACTCTCCCCGCCCAGAAGGGAGGAGAAGAGCGGGGAC
TGTGGCCCGGCCACCACTGCCTGCCTCGAGGGGACAGCGACAAGGCAGGCACTGTCCCGG
TCGGTGCCATGTGGCCTCGGGGCGCTGCTGCCACAGCCCAGCCCGAGCCGTGCTGGAGCA
AAGCGGTGCCTGGTGCCGGGCTGATGCCAGGGGCTGCCAGGCGGTGCTGCAGGGGAGGGA
TGGACACAGCCGCTGCAAACCAGGCACAGGAGGGCTGGGGGTGTTGCCAGGGACACTGCT
TACACCAAAGGGGTGCAGGAATGTGGGGTGACCTCCAACAGCGCCATCCCTGCACGGGGT
GCCACAGGAGCCACCAGTGCCGTCTCTGCTTCCCTGCAGCCAAAAAGATGGTGTCTCCCA
TACACACCGGGGTGCTGGAGCTCCCTGCCCTGTGGGGTGTCACCTCAAAAGCCGGGCTGT
TCTGTTGTGCCCATGGCCGTTCTCAGGCCAAGCTTGGCCCCACAGCAACTCCCCAGTGTC
CAGTTCCATGCCTCCTGTCCGGCCCCACGTTGATGGGTCTGTGCTAGTGGCAGTGTTTCC
TTGGGAAATCACAGCGACACTGATTCCACCCCCCAGCCAAACAAGAGGAGCTCACCACTC
TGGCAGCACAAGGACATCTCTGCAAATATTTGAGCAGTTTATTGTACCTGGGATCTGTAC
AAAAACATGATAAGGCAGGGAAGGGCAAGCAGCCACAGTCACAGCGGGGGCAGAACATGA
TCCCAGGCACACATAGAGCGGGGATTCGTCTGAAAACAGCAGCGGGAGAAGGGATCACTG
CTGAGAGGCTTGAGGGGCCCAGAGATGTCTGCAAGGATGGTGAGCAGTCCCTCATGACTG
ACACCGGACTTTCCTCAGAGCTGTTCCCCCCAAGTGCCCACCGGGTACCCCGGACGCTGT
GAAGCGCCCAGCACTGAGCAGGGACACGTTTCCGCGGTTCATGTGCTGGGACTCGGGCTG
GCAGGCAATGACCCTGCACAGACACGAGCTGCAGCCACCGCCGGGCAGGCGCTTCCCCTC
GGCTCATCCCGAACCGCCGTGCCCGCGGTTTTTCCGCCTGGGCGGCTTTTCGTGCGCAAA
GCGCGGCACCCGCAGCGGGCAGCGCATTCTCGGTGTGCCGGCCCCGGGGCGCCGTGCCCG
GTGCACGCCGGGGCGGAGCGAACTGCCCCGCCCCGCGCCGGCGCTGCCCGCCTCCCCTTC
GCCCGCAGCCTTGACCCCGGTGAGCCGCGGCCCGAGGGCGAGCGGGGCGCGGGGGCGGCG
GGGCGGGCGGGGAGCGGGGCCGGCGGGGGCGCGGCGGGGATGGCGGCGGGAAGCGGGGCC
GGAGGGAAGGGAAGGAGCGCCGGCCGCTGCCCATGTGCTCGCCGGGCTCCACGCGGCCCC
GCCGCCCTGGGCTGGTGGGAAGGGGCAGGGAGAGCTCGGTGCACACCGCCCCTGCAAGCG
GGCAGGTGGAAGGGAATATTTCAGCAGGTGTGGGGCCCCCAGCCCACTGCACACCTGTGA
GGATTGGCCGGAGCGGCTCGTGCATGCCGTGGGATCAGGAAGCCTCAGTGGGTGCTCTGG
AGAGGTGATTCCGATTGGGGTTTTGGGCACATCTTTTTTCCCTGTTGAGCATCACAGATA
TTTGGATTGGTGGGGAGGAAGATCACTTTCCCGAAGTGTCCCTCCTCTGTGCCCCTAGGG
CAAGGTCATTGTTCCCAGACTGTTGCAGGGAGCATGGTGACTCCACGCTGTCCTTGTTTG
GGAGGGGAAGGGCACATGAGCCCATCATGACCCCACTGCTCCCCTCCACTGGTGGGACAC
ACCTGACAGGCGCTGGGGCAGAACAGGAGCGTTTTAGCTGTAACCAGTGTGTTGCTCCAT
GTTTACCAGTCCATGTTCCTGGTACAGGACATTCCCACCATAACCCTTGTCCCCATAATC
TTGCTTACACATGCAGCACACCTCCTCCACTGGGAATCCCCGCTGACCTCCCTTCAGCAC
TCCCAAATTACACGTAGCTCCAAAGGGGACCCACAGGGCTGCATCCAGGGCTCAGGGCTT
TCCTGCTCTGGGACCTCCAGCATGGGGCAGGGTAGCAGAGTGGAAGGCTGGCAGGAAGGC
TGGACATCCTTGGACAGCTCTTTGTAGCTGGTCCCGAAGGTGGCTGCCCTTTCACAGTGC
AAATTGGCTCCTGAGACCCATTTATTTAAAATACACACATTTAAAAGGTGCGAGTTTACA
CGCATATGGATCTGTGCTTGCAAACACAGGTGTGCTGTGTGCAAAGTGGGGGAATGGCTT
TTCCCCAGGGCCAGCAGCCCCCCTGATCCCCTGCGTCCTCCCCGCAGCCTGCCCAGCCCA
GCCATGGCAGCCTCGCTGAGCCGCCCCTGCTTCATCTCCCTCCACCTGCCCTACAGGCAG
GGCTGGGGCCAGCACCTGGCCAGCACCTTTCGCTTCCAGCCAGTGGCCGTGCGGGAGACG
CCGCGTGTCCGGCAGGTGGCCTTGCAACGAGAATCTGCCATCTTCCTCGTCAACGAGCGC
CTGGCACCTGCCAGCACCTCATCCCATGATTTTCTCTATGACATAGATCCCCAGCCCACC
CTGGGCACGGCCTCCAATGTCTGCTTCGAGGTGGATGATGTGCCGGGGCTCTGCAAGCGG
CTGCAGAGCCAGGGATGCTCCTTGCTGGTGCCTCCCACTGAGCTGAGGGATGACGCTGGT
TCTGTCACCTACGGGGTGGTGAGCTCTGTCGTGGGCAACATCAGCCACACCCTTTTGGAC
CGATCCTGTTACCAGGGGCTCTTCCTGCCTGGCTTCCAGCCCATCCAAGGAGCCCCCTCA
GCCACAGGGGATGGGATCAAGATCACTCACTTTGACCACATCACATATGTCTGCCCCCGG
GGCGGGGCCCGGGCGGCTCTGGACTGGTACCAGCGCTGCTTCGGCTTCCAGCGCTTCCTG
CTGAACCCCCGGGAAAGGCCGGCTGAGGGGTATGTGCTGGGGGGACAGGGGGTGGGCATG
CTGCTCCTCGCACTGCAGAGCGCCCAGGGCACCCCAGCACATGGCTGCAAGCTGGTCTTT
GCCGAGTCTCTCTCCCAGAATGGCACCAACCAGGTCGACACGTTCCTGGAGCAGCACGGC
GGGGCTGGGATCCAGCACGTCGGCCTCTGCACCACTGACATTGTCAGCACGACCAGGGCT
CTGCAGCAGCGGGGAGCACGGTTCTTCACACCCCCCACCACCTATTACAGCCAGGGGGGC
AAAGCAGAGGAGATCCGAGGAGCTGGGCAGGACCCCCACACGCTGGCAGAGCTTGGCATC
CTCCTGGACACCACAGTGCCTGGGGACAAGGGTCGGCCGGGCACCGATGCCACAGAGAGC
CCCTCCCAGGAATATCTGATGCAGATCTTCACCCATCCCATCTTCTCCGAGGAGACCTTC
TTCCTGGAGCTCATTGACCGTCGGGGAGCGCCCGGCTTCGGGGAAGGCAATATCCGGGCG
CTCTGGAAAGCTGTGCAGGTCTACATGGACCAGCAGCAGTAGTGCAACACTGCAGTCCTC
CTCCCTCAGCTCCCCATCTGCTCCACTCCAACCCTGGGGCAAGGACCATAAAGATCCCAT
CCCTGGCATGGCCCAGGCGGGCAGGGACCAAGGATCCACATCAATCCAGAGCCAACTCAG
CGTGGGAGCGAGATGCTCAGGGCCAAGTCCAGCAGGGGTGTGAGCATGGCCCAGGATGGG
TGCATTTCTCCCCAGTGATTTATCGACCACATGTAAAGAACTTTCTGCCTTATTTTCAGC
TTAATTTATTAAGACTTGAGCCTGGAGCATGGCCAAGAGTGTGCTGGCACAGAAACACCC
CCAGACGCAGAGAGATGAGGGGCTGCCCAAGGGGAGTGGATAATCCAGAGGCCGTGGATT
ATGGGCCACTTACTGGCAGTTACCACCCACAGCATGACCAGCCCTGGGGGCGAGTGGTGG
CCTCTTCCTCCTCTCAATTAAAGAATTAACTTACAGGCACTGCTTTGGGTTTTTAATCCT
TTTGGGTCTTTTATTTAAGATGTGCCAAGTGCTGGGTCAGGATGAAATGGCCATTTCCAT
CACTCAAAGTGGGCATATCA
Chart Advanced