SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00002844_2.0
Identity
PromoterGlutathione peroxidase 1 (GPx1)
SpeciesTursiops truncatus (Dolphin)
Promoter IDSPR00002844
Promoter release2.0
External IDNone
Transcript SPT00002779_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

ToolboxForward   Reverse    
Sequence
>SPR00002844_2.0 # Promoter # Glutathione peroxidase 1 (GPx1) # Dolphin (Tursiops truncatus) Full length # Reverse
CCGAGCGCTGAGCGGCACACATGGCGTAGGTGCACAAAAAGACAGGGCAGAGCCGCGGGC
TAGACGAACAGGGCGGGCCGGGAAGCGCCTCCTTTTAACAGGCGGGCGACCGAGGTCATG
TGGCTCGGGCACTTTTCCGTCCGCTCCTACACCCCTCCCCCGCTCGGTCCCGCCTCATCC
GGCCTCTGTCCTACGACTGTGGTCCCGCGAAGCTGGAGGGTGCGGTCGGGCCGGATGCGG
ACACCGCCCAGACCGTGCCGAGGCGCGGACGCGTTTGGCCCCGCCCAGGGAGCGCAGCGC
CGGCGCTGTGGCAGTCGCCCGGATTATCCAGGCCAGAGCCCAGGCCGAAGAGGGCTCCGG
ATTCTTTCTCAATGGTTCTTCAGGGATTGGGGCCCGGCACGGGGAGACTCGCCAGCAACA
GAATCTTTCGCTGCCTGTGGCCACACAGCCCTCCCAGCCTATGCCATATTCCTACTCCCC
GAGAAAGTGCCCTATTGTCAGGCGCAGAGGGAGTTGACTTGTGATGATGGTGCAGTTAGC
AGCAGCTGCCAAGGCAAGTCCTGTGTTGACACTTCCTGGTTCTAGGAAGGTTAAGTTGGA
GGAGGGTGGGCAATGCTGGGGAGAAAGGGGGCGGGCAGCCAGGGCTGGACGCCAAAAGCC
AGCTCTTTCTAACCCATTTCCTTGCATTCTGGGGCTGCCCTAGACTGTGTTCTCCTCCTG
GCCTCTGGTTTCCCTTCTACTTTTACACCCCCAGTGTGGCACTACCCTTACAAAGGTTTT
CTGGGGTCACTACTCAGGCCCTGCTCCAGACCCCTGGAGGGGAGCCCAAAAGCATGCAGG
GCCAAGGGGACTCAGTCGATTTCAGACCATCCTCAGCTTCATCTGGAGCTCAGGCAAGGA
AGTAAAAGACACTGAAAATGGACAGGTAGTAAGAAGAGGAAAATATCACACTAAGATTTG
TCCAGAAGAACGACTGCTTGGAGTACCCCTCAGTCGGCTGCATTCCCTACCCCACCCTAC
TCTGAACTTGAATGGGACATAAGATAATCACTTCCACCTCTTTGGCAGAAGCCAGGTGAG
TGCCAGCTTTGGGGTGGGGGTGGGCAAGCCGGTACTTTGCCCCCTGAAGGAAACTTCCAA
GGTGAGCTAGGCAGAGTTCATCCTCCATTCCCAGCCCTGGAGAGAGCCAACACAAACACC
AGGATACAGGAAGTTTAGAAAACTGCCTTTATTCTATTAGTAGTTGGAAAAATTAACTGG
TACAGAAAAAAAGTTTAGTCAGCTGGAGAGGACAGAGAAACCGTGGGCCACCCAAGAGAA
CTGGTGGCTCCTCTGGGAGGGAACCTGGATACAGTGAGAAGAAAGAGCACTGTGAACTAG
AGCCAGACCCTGCAGTCCAGGTGAGACAGGTTATGCCACCTTCTGAATTATCTAAGTGCC
TCAGGCGTAAAACCAAATTCCTATTTACTTAGCCCAGCTCTGGGGAAGGGGGTACTGGAA
TATGTGGGGCCGAAAAGGGGAGACATGGCCATCTTTTATCAGAGAAACTGACAAAACAGG
AATTTAAAAAATGAATTTTCCATCTGACTTTATTTTCAAATACACTTTCTTTTTTAAAAA
AAAAACCAATACACTTTCTGTGAGGATGACAAATATCAGTATTAGGAAATCCAATTATAC
AAAAAATACTACATCTAGTCTGGGGTAGATATATTTATTTTTGGTAACATACATTAAGCG
GCACTAATTACACAGTAACTATAAGGTAACTAACATGAAACCACAGAACTGTAACTTTGC
CACAGCTGCGTGGACTTGGGCCTTTCTGGCTGAGCACATTTTCAAAAAACTGGATTGCCA
CCCAGAGCTATGCCAATGAAATCTGTTAAAATGAGTAAAGCTCTGAAGTGGTGACTCACC
AGAGTACCTTGCAGCTGAAAGATGATAGGCAGGACATGTTAGTTATAAAGTAGTTACAGC
CTAATTCACAAAAGTTACCGACTGTTTCTCTTTCTACAAAGAAGCAAGAAGTTAGGAAAT
TCCTTGAATTAGCGCCTAATGTGTCAGGTGGGAGTGCAGAGGAGGGCTGTTAGAGCAGTG
TCAGAAGGACCCTGGTGGGTCAGGTGGGTTGGACATCATTAATAATCATGGTTGGCTTCT
AAATACTGGTAGCAAGATGACTTCTGATTTGTAATCTTAGGTAAATTATAGATAAATGAA
AAAGGCCAGTAATCATACACTAAGATTAATAAACAGCACTTCAAAATTAACCGCATGAGG
GCTGTGCTTGCAGCAGGGTTTCACAAGACAAGGCACCCAGATTTTTTCTTCCCACGTCTG
GCTTGCAGAGCAGCTCTCGTGGCCATTTCAAAAACCTCCCTCACTCCATCTTTGGTCTTT
GCTGAACACTCCATGTACCCAAAAGCACCAATCCTGTTTGCCATATCTCTGCCTTCTTCC
GGTTTCACTGGCTCCTAGCAAAGAGAAGAGAGCACTTTTAGTTAACAGCGTTACATACAT
ATAGTTAAGTAGGTGTATCCAAATTCATCTCAAAGACTGCTTTTAAAAAGCTGCCGAGGG
CTTCCCTGGTGGTTTAGTGGTTAAGAATCCGCCTGCCAATGCAGGGGACACGGGTTCGAG
CCCTGGTCTGGGAAGATCCCATGTGCTGCGGAGCAACTAAGCCCATGAGCCGTAACTACT
GAGCCTGCACTCTAGAGCCCGTGAGCCACAGCTACTGAAGCCCGTGTGCCACAACTACTG
AAGCCCGCGCACCTAGAGCCCGTGCTCCGCAATAAGAGAAGCCACCACAATGAAAAGCCC
ACACACCGCCATGAAGAGTAGCCCCTGCTCGCTGCAACTAGAGAAAGCCCACACACAGCA
ACAAAGACTCAATGCAGCCAAAAATAAATAAATAAATAAATTAAATTTTTAAAAAAAGCT
GCCGAACTCCCAGATTTGAGTTCTGTCTTATGACACTCATATGGGGTGACCCCCCACCTC
CAATATATAAAAAATCCCTGTCAAACATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCAGAAACCTCAGGAGACCCGTGCAAAACACCTCAAGGCACTCCTCCTGC
ATGTGGGGAAGTCCTATCATTGGGCCACCTGGCTTCTCAGAAGCCAAGATGTCACCTCCA
TCATCACTTTTTTAAAAATTTTTTTATGCTTTTTTTTTTTTTTTTTTTTTGCGGTACGCG
GGCCTCTCCTGTTGCGGAGCACAGGCTCCGGAGGCACGGGCCCAGCCGCTCTGCGGCATG
TGGGATCCTCCCACACCGGGGCATGAACCCATGTCCCCTGAATCGGCAGGCGGACTCCCA
ACCACTGCGCCACCGGGGAAGCCCCACCATCACTTTTATAAAGGCATTAAGGCTCTCTGT
TTGGACTCCCCTGCCATCAGGATTTCCTGATTCTTCAGTTCCCACCAATTTATCTTTAGC
CTCACATATACGAAAGTAATAACTGGAGAGGGAAATCAAGAGCCTGATAAAGTTCCTGCA
TCTGAAGCATTGACTATTGCTGTGATGGTCCTTTCTCAGGCAGGCAATCTTTGGAGCACA
GCACTACCTCACAAGAGAGGTTCCATCTTACAGGACTAGGGAGTTTTAGGGACCCCCTCT
ATGCAGGCCCGAGTCAGTGAGGGCCGGATGGACAGAGAGAGGCTTCTGGGACTTTCTCTG
AAACAGCCTGGTCTTTGGGGGTTTCTGCTGGGTTCCCTGAACCTCGAACCCAGGCCCCGA
GTTTAAGAATGCTACAGGAAGACAGAGCCCTGCCCTAGACCATACCTGCTTCATCTTGGC
TAGCTCCCGCCTTGTGTGCTCATCATTTCGAAGATCCTTCTTGTTCCCAACCAGGATGAT
GGGCACGTTGGGACAGAAATGCTTGACTTCTGGAGTCCATTTTTCTGGGATGTTTTCTGA
AAGAAGCAAAATGCACATAATTTGGGGATACATATAATTCTATCTTGAAGGATCTCCAAA
AACCCTAGTTAAATTGCAAAGAAACTTCTTGAGAAATATGCCGGACATTTAATGGAATTC
CACTAGTTTCAAAACCATGAAAAAGGTAAAATCTAACCCCCCTTCTCTTAAGCACAGAAT
CACCAGCTTTTCTCAGTCCCACCAAGGAGCTCAGCTCCTCTGGAGGTGGCACCAGGTAAA
GGCTCTGGAGGAGCAAAGGATGGCTCCACAATGGTGCCACCTGCCCCAAGAAGGAAGGCT
CCCCACCAGCCATCCATGTCACTGCTGGCAGATGATTCTGACCACAGCTTACAGAAGGAG
TCCCCATTCTGGGGCTATAGCTGGCTCAGGGTTCACATGTTTTCTCTACACTTACTCATG
GGCCCTCAGCATGACCTACCCTTGGATTACTGGTATTTCAAATGGCTTGAGTGGCTTTTG
AAAATGAGTAATAACCAGCTGTAGCTTCTTGCCAATACTGTAGTAATTTAGTGGACAAGT
GGCCTGGGTTCAACCTCACACACCCACTACCTTGAACATCTCAGTGTCAGGGATGACACT
ATAAAATGGGGATAACAGTAATACCTTACATGAGGTTATTTTGAGTCAATGCGTACAGAA
TACTTAGTATGATGATCATTTAAATGGTACTGATCATAAGACTATATTTTAGGAGTAAAC
TGTTCACTCTCTGACTTCAAGACCAAAAGGCAGGAGTTGGAATATAAAAGATGCTCTGCC
TTCTGGCTAGAAGGTACAGAAGCTACATGAATAAGGTCAGGAAAACTCATAATTCTACAC
TCCACTCTTCAGCACACAAGACAGACATTTGTCTGCTTCCTTCCTCCTTTGCTATAGCGG
CTAGAGTCAATCACTAATGTGACAACTTAAAACTCAAAGCCTTATTCTAGAACAAAGGGG
TTCCCAGAGAAGTGCAGAGC
Chart Advanced