SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00002949_2.0
Identity
PromoterSelenoprotein R (SelR)
SpeciesXenopus tropicalis (Xenopus)
Promoter IDSPR00002949
Promoter release2.0
External IDNone
Transcript SPT00002884_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

ToolboxForward   Reverse    
Sequence
>SPR00002949_2.0 # Promoter # Selenoprotein R  (SelR) # Xenopus (Xenopus tropicalis) Full length # Reverse
AATCTTTGGGGAAAATATGGGAGAGTCATATCTGGCACATAATGCACAGTGTAAGGACAC
AAAAGTCCATCTCTCCTGTATTAGCCCAATCCGAAGCCACGTTACAGAGCGTTAATGGGA
TTCACAGATAAGGCTTACTAGTTGTAAGTGTCACTCACCAAATCCCTGCTCCTCAGAGCC
TACAGCCTAATCTGTTGGTGCCTGAGACAGGGCCATTTAATGGAGTAAAATCCAGGATTC
CCCATACCCATGTCAGTTCTCAGCATATGAGCCACTCCTAATTGCAAGCATGGTTTGGGA
AACTTTCTAAAACACTAAAATGTAGTGTAGTTACTACAGGAATACAAGCAGTAGCCATAA
TTATGTGTGAGTTCACTGGTAATGTTCCTACATTCAGATGAAAACTTGTGGAACCAACCA
AACCTGCTGTTTTTGTGTGTGGCACCAGGGGATGTGTTTATAAACACTGGAGACAAACAT
TACCGGTGATGTTGCCCATAGCAACCAATCAGATCTTTGCTTATGTTTTCAAACTTGTAG
GTTCAAATCTAATTGCTGATTGGTTGCTACTGGCAACATCACTGGGGATGTTTGTCTCCA
ATGTTAATAAATACACCCCCAAGTGTACAGCTCAGATGACAGTTAGCATGTCACCCCAGG
GCACATAATGGAATGTTAGAATTAGCAGGAATGTTTATTATTAGACGTCAGCACTCTTGT
TTGCATATCCCTGACCATGTGGATTAGAGTTACCAAGTTCTTAAAAAAGAATGAACTGTT
CTTTTCTCATGGAAATTACCCAAAGCCGGATTTACAATTTCGGCACCCAGAGGCCGCTCC
CATTCCCTGCCCCTATTGCGTACATTTTGGCGAATCAGATGCAATTGCTGCAGCCACAGC
TCCATCAAGAGAACTGTAAGGAAATTGTGGGAAAAAAATCATAGCGCTTGCACTCGAAAT
TGCACTTTGCTCACTGCACCTCCGTAAGTGAATGTGCCCTTACAGCAGCTGTGCAGTTGG
TCAGATTCAACTATGCTGCCCAGCCTCCCGGGTATGTGCATGCTTAATGGCTTATTGAAT
GACCTTCTGGACTCCTACTGCCCTTCACCCACCCTTTACACTTTGCCTTTCTTTTAACCC
AGCCTTCCCTGTAGGGCGCTATTAATAAAAATAAGAACCTTATCATTTCTGCTGTATGGA
TGGTGCTGTTCCTGGAAAGAGGAGCCTGTGCCACAGAGTTCATATTAGAAGTCAGCTCGG
GTTATCAGCTCCAGAAGCTGCCAGTTTATCTGCACATTAACACTGATGGGAAGAAAGCTG
ATAACACTATCACGTACAGTGCCGGCTATGGCTCAGAATTACTGTTCCTGAATTACAAGC
ACGGGACTCTCATGTGTGACATAATGGCCCTATTTGGGCACACTGCTACCTGAGTGGCCA
ATGTTAGAATGTACTTTCCCCACTCATGGCTTGTATTCCACAGAATACCCCGGGGGCATA
ACAAGGGGCATAAAGGGTAGTGTATATACTGCTGGCCATACACAGAAACACTTGCTTGTT
TGGTGAGGACACCAAATGAGTGGATCTTTCCCTGATATGCCCACCTTCCAATATTGGGCG
GATCACATGATCAGATTTGGTCCTTGCACTGATGATTTTTAAACCTGCCCAATCAAGCAG
GGGTGTACTTAGGTCCTAAATATGCCCCTATGTCATGTGTGTGATGTCACGCGCACTGTA
TGTGTGACACCACACACACCGACGTCACTCCCATAGCGTGTCCAGAACCCCTGGCCCCCC
CGCCCCTGGCGCAGATTTCCATAGGAGGGATAAAAAAGAAAATATAGGCACAAGTGCCCC
ATAACAAATAGAGCCCTGCAATTAATACCTCACAGGCCCAGACTGGCTGCAGCTTCCGGC
AAATGCCAGAGGGGCTGCTGTAAGATGCCATAGACAGTGGGGGGCGCTATTTAGGCCTCT
ATATACTTGAAATGCAAGGGCAGGCTTTATACCTGCGTGATGTTCAGCCAGATATCGGTC
AGGCAGACCAATCAAAGGGCCCCATGCAGCCTGTATCTGCCCATGTAGATGATAAACTGG
ACCTACACAAGGTATTAAAAAGAGGGAATAAAGTTGTGGCTCTATAAAGAGCCAGCAACC
AATGTTTGCTTGTATTTGGGCACCATTATTAAAGGGGAAACTAAGCCTCACCTTCTAGAG
TTCCTTCTAGATTCCCTTCTTTTAATACCTTGGTGGGCCCAGTTTATCTCTTCTATGACT
TCACTGAAAAACCTCCCTGCTAATAATTTTTATCATTTTACAGTTTACATAAGTGAGACC
CTTGCACCTTCCAGCTCCTCTAGAACTATAATTTCCCCAAGGGACCCCCTGAGATGCTTT
AAGCCCTGATCAAATGCCCACCCTGCCCTACCATAAAATCACCCCTAAGTGCATTTGAGC
GATGGATGCAATTGATTTGCTTTGTACAGTGTGGATAATGCCAGGGTGATGCCAATCCAT
GCCAATATAACTGATGGCAGAGATATTTCAGCAAATGATAAGAGGGCACATGGGAGACCC
CCTATTGAGTATGTACAGAATGTATATCATTCCCTGACCTGTGCAGTGAGAAGGACCCAT
AACCCTGAGTAATGGTGCTGCTGCTGCTGATGTAGCATTATTATGAATGGAGCCCCCACC
ATTACAAGACGTCGATCCACATTAAAAGCTAATTATACTGTAGCCCCTCTGAGTATGCTA
TCAATTAATCCATTTGGAATCAATATATAGCATTAGGCACAATTCATTTCCCCAGTAATG
CCATCTGCATGGGGGATACTCCATCAACCATGAAGTTTGCTAATTAAAATCAGGGGGGTT
TGGGGAAGGAGGGGGGTTTATTTGCTCCTGAATGTAATTCCCTGCAAGCGGCCACAGATG
GTGCAAAGGAGAATGGAAATTTCCAGCCTATATACAGCGCTTTGCACTGTGCCAGTGTAG
GGGAGTAAGGGGGGCATTTCCCTCCGCTGCCAGTCAGATGGCACCGCTTGCCCAGCGCGT
CGTGCAACTGCTTACCTGCTCCTGTTTGCGCCATTCTCACTCGGCTCCAGGCTTGCAGTC
TCTGTGCAGTCACCGATGGGAAGGAGATCTCTCTGACCCGCAGCAGCAGTCTAAAGCCTG
TCAGTAGCCGGCTCATGGTGCAGGCAGCACAGGGACTGGGGGGCTACAGCAATGGCAGGG
GATACCCGGCGCTCCTCACTCTCTGCTCGCTGCAAAGCTCTCTCCTTGCTCTGCTCCAGC
CCAGCTCAGTGTGCCCCCTTCCCAGGATAGTGTAGGCAGCTGTCTCTTACCCCTTAGTAG
GGCAGTAATGCAGCTCTCTTGGCAAGTTGGTTGTCTGTAGCTGCTGCACAGTAACTGTCT
CTGCACTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTTGTATCTTTCCTGAATGATAGTGCTCCCTGTGTGTTCTGTCAAAGGG
GTTGCCACCCTTTAAACTATGTAAAATAGGGGTCCCCAACCTTTTTTAAACCCATAACCC
ACAATTAAATATTAAAAAGTTGGGGAGCAACACAAGCATGAAAAAGTTCTTAGGGGGTGC
CCAATAAGGGCTGTGATTGGCTATTTGGTATCCCAATATGGACTGGCAGCCTATAGGACA
CTCTGTTAGGCAGTACACATGGTCTTTATGCATTCTAGGGGGAGATTTATCAACCTTGGA
CTTTCTTTTTTTTCACCATTCAAGTTTTTTTGTGCTAAAAAAAACCTTAAAACTCAAATG
TCTGGTATTTATTAAGTGCAAAAAACGAAAAAACTCCAATGTAAAAACTCCCATATACAG
TAAAAGCTTGAAAGTTCCTATAGAAGTCACAGTAGAGAGTGCTTTTCTGAGACAATATGG
AATCGGTCTTTATTTTTATTATTATTATTATTATTATTATTGTTTAGCTTTTTATTCAGC
AGCTATCCATTTTGGAATTTAGGTGCTGGTTGCTAGGGTGCAGTTTAACCTGAACAGGCT
GTGGTTTGAAAGAGAGACAGGAATATACAGTAAATAGAGGGGGGCCTAAATAGAAAGATA
CGTAATAAAAAGTAACAATAACAATAGATATGTAGCCTCACAGCAATGGATGTTGGGCTG
CCGGCCTCCAGTTAAGAGGTGTAACGAGGCAAAAGAGGAAGGCAAATAATTAAGAAAACT
ATAGAACTAAGAATAGGCCAGCCTCACTGCACAATGATGTGTAACACAAACAATCCGGAA
CTGAAAATGCAACTGCTGAGGATGCAATCAAATAATATAAAAAGCAATTAGTGATTATAT
GACTTACACAAATATTTGCACGATTATTGCTGTTAATATCGTGCTGCTGTTTCCCCTTCA
GGCTACGTGGAATATTTAGATTTTTTCTGATGTTCCCAGGGCAGTTGTACATTCATTGTC
AAGGCTTGATATACAATAATGAATAATAAGGCAGGCATCAGCTCACTGGATATGTATTTA
TATTTCTTTTTTTTTTATGCAGAAAATATCAAATTTCAGACCGTTACCAACAGTCGCATA
TACAGTTTCTTTTCCTGCCTTACAGGTATTTTGGGGTTATTCCATATAACACCTTTGTTC
CATCCATTAGCAATAAATTAAAGGGGATCTCTACAAAAACATACGCTTTAGCCTGAAAGA
ATAGGTGATTCTAAACAACT
Chart Advanced