SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00003203_2.0
Identity
PromoterEukaryotic elongation factor (eEFSec)
SpeciesXiphophorus couchianus (Monterrey platyfish)
Promoter IDSPR00003203
Promoter release2.0
External IDNone
Transcript SPT00003136_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPR00003203_2.0 # Promoter # Eukaryotic elongation factor (eEFSec) # Monterrey platyfish (Xiphophorus couchianus) Full length # Forward
AACATCTAGGTCGTGCAGCGTGACATCTTGGACTATTTCCTTCTTCTTGTGGACGTCGCC
TTTGGGAAGTGGGACGTACTCCTCGGCCTCAAGGTCGAACTCCGTTGCAAAGGTGTCACA
GCGGCCTTGCCTCTGCAGAGACATCACGACACACAACTCTATTAACAAAGAAATAGAAAT
CTCGTCTAAATGCAGGAGCAGAGCAGGGGGAACGAGGGCAGGTGTGTGATGCGGCTGCCA
GCTCATTGCAGAGAGAAGGCCTTTGGCTGAGGGATCAAACAGAGCATGAGGCTGCTGTCA
ACAGTAACAAATGTGCCACCCAGTCCTCTTCCTTTGCCGCTCGACTACAGCCGGCCCGAT
CCCCTGGGCCCCTCGCCCACCTGCAGTGATTAAAAGAACAGTCATCACAGCCTGTCAGCG
CAGGCCACGATCCCCGCTGCACTGAGAGATGTAAAGATAGACGGAGAATGAAGGGCTGCA
GGAATGAGAGCTGCATGCAGGGCGGAGAGAGATGAAAGCAGAATGCCACCATGAAGGAGC
GAAGAGGACAGGAGGCAGGAAAAAAAAAAAAAAGACTCAACTTTGATCTCAGGAAGAATT
TATTCTTTTCGTGACATAAACACAATCCATGTTTAGTTTGAAGCGTTTTTTATTTTCTTG
TTGACAAATGTGCTTCATATGGCTGGAAATGAGGAAAGCGTCTGGAGTAACGACACACAA
TGTGAGGCAGATCCTGATATTGGCTTCTACCATTTATTTTTACCCCCAAAATTCCTGAAA
TCACTTAATAACCACAGAGTGAACATCTACTAGCAAACAGTAAAAACACCTGAATCTGCA
TTAAAGAAATACTTCAGTATGAAACCTTTTAGAGCTTAAAAATAAAATTTCTGATTTTTC
ATTCAAAATCCCATTTCAATAATTTTTACTTCCTTTCTTTCCATGTCAGACTAAATCCAC
TTTTATAAAACTTAAATAACTTCTGTATTTAATTGCTGCCTAATTATATTGTATGTTCAT
TGCTTAGATCAGGAGTTTTCAGTGCTGTTTTTCTTTCTTTTTTCAGAACTCCAGGGTCCG
TGATCTGCAACTTTTAGATGAGTTGCTGCTTCAACACACCTGAGGTCAATAGCAGGACTC
TGGAGAACTGGACTACATACTGAGGAGGTGATTCAGCCATTTGATTCAGGTTTATTGGAC
AAGGGAAACACCTAAAAGTTGTGGGACCCTGGCCCCGGCAGACTGAAAATGGCCCCCGGC
TTAGAGGATGGAAAAATTTTTTATTATCAAAGACACGATTGGAAACTGGCAAAACAATAA
ATCAGCCAAGACAGCACTGACTGAAATCGAGTGTTTTTCTTTTCTTTTTTACCAAAATTA
GCTCTTGGCTTTTTTTTCTTTAACAGGTATGAACAGAAGAAAGCATTGTTCATTCATAAA
AAATCATTCAAGAGAGGAAGACAGAGTCTACTTTTTAACCACAGCCCATGCAGTCACGAC
TCAAATTCATACTATTTCAGTTTTGAAGAAGCAAAATGATTCCTGTTTCACAAAATGAAT
GAAAGTTTACCTTGACAGCACCACTGTTAGCTTCGATGTAGATGACGTCTCCCATTTCCA
CACGCTCTTTCTGAAGACTCTCATAAATGCTGGGATCCAACTAGAGAAAGCGTAAAAGCA
CGTTTTAGGTCAACTCTAGGCCATTCATGTTGCACAAACTATACTTTAAAATGAGCAAAA
TTGCTCCTAAAATATTAATCTGATCCATACAAATAAAACTCAAGAGAAGACAAATACTTT
AAACAATTCCAAAAACTACTAATTTAATTTATCTGTTCATAATGGTGTTTATTAGACACT
TTGCTTCCAGTTTGCTGGCAACAGTCGAGGAAGAACAGATAAAGTAAAAAAAAAAATTTG
ACCTTGAGCTGCTTGGTGCCTTTGGCCGTCTTCAGACCGATGATGACGTGGCTGATGGTT
TTTCCGTACCCACCCATAGGATTCTCCGTCTCACAAGGGGTCAGCTCTGTCACCTCCCCT
TCATACACCTCCTTTGTTTCTTTGATGCGCAGACCTGAACGTACACACACACACACACGC
TTCATAATGAGGATTCAATAAGGTCTTTATATTCCCGTCTCAGCTAAGCCGCCACATCTT
TCAGACTGCTGAATAATGCCTTTTATTACAGGAAAGAACGTGTGCGCGCCGGGCAAATGC
CCGAGCATCAGTGTAACATGATCACACCTCTTTCACAGAGGCTGTGGATCTGAGCATAAG
CGGCACACAGGTGCCTGGTCCTCCATGTTGAGGGTCAGAGAGCTGTGCTTAAGGCAGGGA
CTGTGTTGCAGAGTTGCTACTGATGGGGTGACGACAAACGAGATGAACCCCAACCCCCAG
GTTCCTGCAAAATCCCTTCTAGAGGTGAAGCCAATGTGATGTTGACCAACTCTGTCTCTA
TTCTCTTCTCAGGGAAGAGGTAACATCATCAGTCAGCCAAACCCTTTCTGTTTTTCTTTA
TTAAAAAATCTTCTCTGTAAATTCACTTCACTTCCATGAAGTGTTAGCTTGAAGCTAAAG
GCAGCAGATTTAATCAGGACATCCAGTTTCAATGAAAGTGAAGTTTTAAGAAAAACTCTT
TACACACAAACTCTGGCTCTATGTTTGTTGAATAAAAGCATCCCTGTTTCACACTACTGG
TGTAAAAGTAGCACATATTGAACTTATAAATAAATACCTATAAAAAACAATAATATATAT
ATATATTCCTGCATATGTGTGTCTAGGAAAGTGCTTTTAAAAATAAAGGTGACATGGAAT
GGTATGGTATATATCATACTTACCAATTGCTCTCCTAAAGTTCTCCATAAGTACTTCTGT
TTTTTTAATTTCAGATGAGTACACTTCACTGCCAACCATGGGACAGAAAGGAACCTTGTT
TCCCAACTCCTGTGCCATAGCTAAAGCGAGGGCAGTCTGAAGGTTGAAACGCAGAAAAGA
GAGGCCAGAATAATAATCATCATTCAAGTAAAAAGTCCAGTTAATGAGCTTGTACTCATA
CTCGTATCTCAGCACTTTGGAAAAACAGTGCACAAACCTTTCCTGTTCCTGGAGGTCCTG
CCAACAAAACTGCTCTTCCTGCCATCTTTTTTGAGCGGATCATCTCAACAATGATTCCAC
AGGCCTGAGGAAATCGAAAAATGATGTGTATAAAAATTAAGTGTATTCATACACAAAATA
ACTAAATGTTTATAAAAACAAATACGTCCACATTGGAGAGGGGGGCTTGATGTAAGGTGC
AACACAAACACTGAAGACACAAGCCACAAATTCCTAATGTGTTGCTGTAATTAAATGAAA
ATAAGGCAAGAGAAAAAAAAAGCAAAAATATATGATTTGTTGTCTTTAGTCAAGAACTAA
TCAGACTTTAATGGGCCAATACTCATTCCCATTTGTTGGGTCTTATATGTCAGTTCTGAT
TTTTCTTTCCAAGGAGAAAAAGACATAAAAACGATCTTGGGTAAAAATTGACTAAACATT
GTGCTGAAGGGTCTTTGACATAGACAACAGCTCTGAATCCAACACAATGTGAAGAAATTA
CAATAACAATTTCATGCATGTCCCTAACCATTTTTAGATTTTCTAAATACAAAACCTGAA
ACACAAACATTAAAAACCACACTGAGACGTCTTGAAACCAAAACAGAGCGAATGTTTGGC
TTAATGCAAACATTAAGCCAACACTGGGACTCTTTATGTAACCATAAGGAGTTTTTCATA
AAGAGTGTATAATTTACAATATTACTATTATACATCTAGTTTTTGTATAATAGTAATATT
TTGTCTGGTTATTATTAACCTCTCCATTTAACATAAAAATGTAATTAAGCATAATATTAA
TACTACGATCTAATATAAATATTATACAACAATGATTTGTCATAATTATTCAACTCTATT
CCATGAAACAATTAAATCGATCCCAACTTTAGAACTTTGAAATAAGAAGCGACCTAGCGG
TGCTAACAGCGTTAGCATGTTGTCCACTGAATGACCTGCGTTTAGCTAAATATTACTGGC
AAAACGAATATTATTTAATGGCTTTTATACACAGATGAATAACACCAATGTAGTGAAACA
TAAATATTACCTCTCTTGCAGTCTCCTGCCCGACCAGTCCACATGCTGTCTGTTTAGCAT
TTCCGGCCTCGTCTAGCCCGAGTCCTTTGACATGACTATGTGAGGCGATCCTTTGGGTTT
TCGTGGTACTTTTTACCTCCTCTATCTTCATAGCTGTGTTATTTGGGTTTATGTGCAATC
TAGAAGTCGCTAGTTTTCCTTCACACCAATAAAGACCCGATTTCCCGATTGATTATTTGA
AACAGCCGAAGTCGGCGCCGAAACTCAAAACACAGGGAACTCGGTTTCCATGTGGGTTAC
TAGGGAAAGCGAGCGGAAGTGCGTCCCCCTAAGTTCCCGCCTACTGTGAAACATCTGAAA
TATGATTGGATCCTGTGAAAATATGCAAAAAATGTAATTGGCTGAGAATAGCTAGTCTTT
TCCTGTGTGTTTCATTTGGTCTGTCGTAGTGAAACAACGAGACACTTGCTACAAATTAAT
TACATGTTTCACTGTGCGTGGGTACAATCATAGAAATATTTCAACTGACATTCATATTTT
GATAAAATTCAAGTGTCGCTATTTGAGAATTATTGATTTTATACTTTTATTTTATTTTGT
TTACTTGCAAAAGAGGTTCCGGTTTAGCTTGTTTTCCGAGGGTGAAGTTCGCTGATATCT
GGGAAGACGTTTCTTTCAGTAGAAAAGTTGTTTGTAGCCAGCTGCATTAGTATGTTTTTA
TTTTAAACATATATTAACAACAAACATTGCCGACGGAAGGATTGGTGCGGAAAGTAACGC
GCCGTGGTGAGTTCAGGGTCCGATTCAGAGTGAAGGAAAACGCGCATGTTAGATAATACT
ATCTCCAGACCGTGGAGAAA
Chart Advanced