SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001518_2.0
Identity
SecisSelenoprotein T (SelT)
SpeciesIctalurus punctatus (Channel catfish)
Secis IDSPS00001518
Secis release2.0
External IDNone
Transcript SPT00003205_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

ToolboxForward   Reverse    
Sequence
>SPS00001518_2.0 # SECIS # Selenoprotein T (SelT) # Channel catfish (Ictalurus punctatus) Full length # Reverse
GCAGTGGGCGGAGCATCCAGCCTGCACCGGTAGCAGGACTACTTTCAGTGCAGACCTTCA
TAAAACGTCACCTCACGACCGCAGG
Chart Advanced