SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000953_2.0
Identity
TranscriptMethionine-R-sufoxide reductase 1 (SelR1)
SpeciesFelis catus (Cat)
Transcript IDSPT00000953
Transcript release2.0
External IDNone
Gene SPG00000857_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

ToolboxFull length   Spliced   5UTR   CDS   3UTR         Forward   Reverse
Sequence
>SPT00000953_2.0 # Transcript # Methionine-R-sufoxide reductase 1 (SelR1) # Cat (Felis catus) # Full length # Reverse
AGCCGTCACAGATCATCACCACTCTGGCTGCCTGGAAGGCTTTGACCAGAGTGAATCATG
TAGTGACCAGGGCCGGAGCAGCCGGCGAGGGCTGCCTCCCTCCACACCCTGCCTCACGGC
CCAGCCTGGGGGAGATGGGAATGAGCTTCGGTGAGGGCCAGAGCCAGGCTCAGAATCGGG
TTCCCCGGGGGTGAGTCCAGGCAGACGGGGAGGGGGCAGGGGGCTGCGGAGAAGAGAAGG
TGGGGTTGTACCGTCATGCAGAGACCAGCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCCCCCTC
CCCGCCCCGTCTGGATGTCTGGGGTTCCGATTCCGAGGTTGGACGACCGGAGAGTGGCCA
CAGCACAGTGTCCGGCTAGAGTAAGTATGTGCTGCCCGCCTACGGCTCCTGAGAGGCAGA
AGTTCCTTTGCCTAAAAGGACGGACGGAGAGAAACACAAATCACTGCTAAATTATGCTCC
AGACACCATTCCCCGAGCTAGGCGCCCCGCTCCAGCCTGCAGAGCAGGGCAGCTGGGAGC
ACCCGGGCGCCCGGCTTGGGGGAGCCTGTGTGCCCCATTTTGTTCCCCGACACCTCCAGG
AGAGCCCAGTCTCTCCTTCCTCCACGGGACAAAGGCCAGTAACTACAAAAGGACAAAATC
ACGTCACACCTTACCATCGCCGGCCTCACGGACCCTCTCGCCTAGCCTCACTCCCTCAGG
ACAGCAGCCAGCATGTGCTGTTAGCAAGCCCATTTTACAGAGGACCGAACTGAGATTAGG
GACTGGTCACGGCCCTGCTGGCGGCAAGTGGGGAGCTAGGATTGGAGCTACCAAGCGTGG
GCAGGAGTCCAGAGGGGCCGGCGGCGCAGACAGACGTGCTGACTTGTGAGAACCTGTGCG
AGCAAGAGGGCCAGGGCCCAGAGGCAACGCTGCGCCCAGATAAAAACCCACAGGAGAGAC
AGCTGCCGAACAAACCCCAGCACCGGGGCCCTCGTTCCCAAGACGTGGGCCACTTTGCTT
TTACGCTTCACGTGCGTTACACACGCGTTATCTACGTGAATGAGGCAGCGGCTTTAATCC
TAAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTATAAGAACAC
TGCTGGGGCGGCTCAGTCAGTTGAGCCTCCGACTTCGGCTCAGGTCGTGATCTCGCGGTC
CGTGAGTTCGAGCCCCGCGTCGGGCTCTGTGCTGTCAGCTCGGAGCCTGGAGCTGCTTTG
GATTCTGTGTCTCCCTCTCTCTCTGCCCCTCCCCTGCTCACACACTGTGTGTGCGTGTCT
CTCTCTCTCAAAAATAAATAAACACTAAAAAAAAAAAAAAAAAGGAAGACCTGCCAACAG
GAGGACACACGGGAGCGCTTACTGTGTGCCAGGCCCCAGGTGCATCACATCAACGCGGCT
GTCCTCAAACAGCCCCTGAAGGAGGCTCTGCGATCACACCCACTATGCAGAGCAGGAGGC
CAGCTCAGAGAGGCTGAGGAGCAAGGCCGTGGCCACACAGCCCAGCCCTCAGCGTCTGCC
TGGCCTTGCCTCCCCCTCTAATCTCTGGGAAGGTCCAGGCCCCCACAGAAAGCCCTTCAC
CACAGATGCCCCTTTTTGGGGCACACGTGACCCATCGGGACACCTGCCCTTGTCCTTGCC
CTGCAGCCACCTTTTTGGGGTGGCCCTGGGCAGCTCCTGGGCAGTGTGCTTGGGTGTCCC
GATGCTTCGTCACTGCGAGTGGACAAGAACCGTGTGTCCCCCACCCCCGGGCCTCTGAAA
TGTACAACAGGCCTGTGTCCAGCTGCTCACCTTTCGGGATGAACTTCAGCGAGCTGCTAA
ATATTCAGAAGCGGGACTGTCCCGGCTTGGGGCCATCGTTCAGGAACTCATGTCCCAGCC
CATTGCCACACCTGCCACAGGACACCTGGAAAGACCACAAAACAACTGCAGCGATGGCCC
CCCTGCCACCAGCAGAGATGGTGTCCTCCCCCCACCCATTTCCCAAAGTAACTGTGGGCA
GGAGAGGTCGACCTCCATCCCGGAGCCCGCACGGGAAAGCAGTCCTGTTTCCCCGTCTCC
ATCAGGACCCCAGGCTCCCCAGGCAGGGTGGCAGAGGCCAGAAGACCGGCACAGACAGAC
TCTAAGCCCCGAGAGCTGTGGGGGAAGCAGAGAAGGAGCAGCCACCTCGGGCTCTCCCTG
GCCAACACCCCTCCCCACCCCCTGGGGCTGCCACCCACCTTTAAGGCTTTAGGCGAATTG
TGCTCCGGACGCTTGGCCACACTATCAGCATGAATGGTCTCAGTGAAGGCCGGCCACGGG
GACGAGTGTGCATACTTTGAGCAGCTGGAGAAGAGCTCGTAGCCACACTTGGCACACACA
TAGACACCTGGGGGCAGAAGGGAAGACAAAGGCAGACACGTTGGCTCCAGCCTCTCTGGG
GTGAG
Chart Advanced